Jdi na obsah Jdi na menu
 


Pulovr s 3/4 netopýřimi rukávy

novinka

Cena: 890,00 Kč

Kód produktu:K190
Záruka:24 měsíců
Výrobce:JV-design
Dostupnost:S,M,L,XL

Pulovr s 3/4 netopýřimi rukávy je volného střihu, je pletený žebrovým vzorem. Má lodičkový výstřih.

Délka 62cm.

Materiál 50ba/50PAN. Barva bílá, středně modrá, mentolová, čokoládově hnědá, vínová , červená, světle žlutá, růžová, t tmavě šedá, oranžová, jeansově modrá... 

Momentálně vyprodáno. Jinou velikost nebo barvu zhotovím do 1 týdne.

Požadovanou velikost (S,M,L,XL) a barvu napište do poznámek při objednání (3.krok objednávky).

Komentáře(5)

Jméno:
Předmět:
Text:

how much furosemide can i give my dog - jataEmite

18. 11. 2022 21:43
The results, as published last year in the Journal of Clinical Oncology, show that abemaciclib plus ET yielded superior IDFS in comparison with ET alone P lasix common side effects

stromectol for osteoporosis - StigemS

17. 11. 2022 15:24
Zamorano JL, Lancellotti P, Rodriguez MuГ±oz D, Aboyans V, Asteggiano R, Galderisi M, Habib G, Lenihan DJ, Lip GYH, Lyon AR, Lopez Fernandez T, Mohty D, Piepoli MF, Tamargo J, Torbicki A, Suter TM stromectol dose

doxycycline hives treatment - outsina

17. 11. 2022 13:02
Pires LA, Hegg R, Valduga CJ, Graziani SR, Rodrigues DG, MaranhГЈo RC doxycycline side effects eyes

marijuana and clomid - impellGop

14. 11. 2022 16:57
fastest way to get clomid pct A Cochrane meta analysis evaluated the effect of massage on neck pain in 19 trials

how to get nolvadex and clomid - Rastilm

12. 11. 2022 7:38
The following primer and probe sets were used PHD2 Fwd, 5 GCCCAGTTTGCTGACATTGAAC 3; Rev, 5 CCCTCACACCTTTCTCACCTGTTAG 3, PHD3 Fwd, 5 TCAACTTCCTCCTGTCCCTCATC 3; Rev, 5 GCGAACATAACCTGTCCCATTTC 3 nolvadex during cycle 9 billion that benefit and tax fraudsters cost the taxpayer every year must now influence lawyersГў decisions on whether a prosecution was in the public interest